F CTAAGGTGGCCAGCGTTTCT MAP1723.R GGTTGGAGACAACCTCGTTC IS900(MAP1771c)   MAP1770c.F ACAATTCGGCGATCGTCTCG MAP1772.R

CGCGGACAGACACAGGTAGG IS900(MAP1785)   MAP1784c.F GTCGACCATCGCTCTTCCCT MAP1786c.R ATCGGTGTCGAGGACATTCC {Selleck Anti-diabetic Compound Library|Selleck Antidiabetic Compound Library|Selleck Anti-diabetic Compound Library|Selleck Antidiabetic Compound Library|Selleckchem Anti-diabetic Compound Library|Selleckchem Antidiabetic Compound Library|Selleckchem Anti-diabetic Compound Library|Selleckchem Antidiabetic Compound Library|Anti-diabetic Compound Library|Antidiabetic Compound Library|Anti-diabetic Compound Library|Antidiabetic Compound Library|Anti-diabetic Compound Library|Antidiabetic Compound Library|Anti-diabetic Compound Library|Antidiabetic Compound Library|Anti-diabetic Compound Library|Antidiabetic Compound Library|Anti-diabetic Compound Library|Antidiabetic Compound Library|Anti-diabetic Compound Library|Antidiabetic Compound Library|Anti-diabetic Compound Library|Antidiabetic Compound Library|Anti-diabetic Compound Library|Antidiabetic Compound Library|buy Anti-diabetic Compound Library|Anti-diabetic Compound Library ic50|Anti-diabetic Compound Library price|Anti-diabetic Compound Library cost|Anti-diabetic Compound Library solubility dmso|Anti-diabetic Compound Library purchase|Anti-diabetic Compound Library manufacturer|Anti-diabetic Compound Library research buy|Anti-diabetic Compound Library order|Anti-diabetic Compound Library mouse|Anti-diabetic Compound Library chemical structure|Anti-diabetic Compound Library mw|Anti-diabetic Compound Library molecular weight|Anti-diabetic Compound Library datasheet|Anti-diabetic Compound Library supplier|Anti-diabetic Compound Library in vitro|Anti-diabetic Compound Library cell line|Anti-diabetic Compound Library concentration|Anti-diabetic Compound Library nmr|Anti-diabetic Compound Library in vivo|Anti-diabetic Compound Library clinical trial|Anti-diabetic Compound Library cell assay|Anti-diabetic Compound Library screening|Anti-diabetic Compound Library high throughput|buy Antidiabetic Compound Library|Antidiabetic Compound Library ic50|Antidiabetic Compound Library price|Antidiabetic Compound Library cost|Antidiabetic Compound Library solubility dmso|Antidiabetic Compound Library purchase|Antidiabetic Compound Library manufacturer|Antidiabetic Compound Library research buy|Antidiabetic Compound Library order|Antidiabetic Compound Library chemical structure|Antidiabetic Compound Library datasheet|Antidiabetic Compound Library supplier|Antidiabetic Compound Library in vitro|Antidiabetic Compound Library cell line|Antidiabetic Compound Library concentration|Antidiabetic Compound Library clinical trial|Antidiabetic Compound Library cell assay|Antidiabetic Compound Library screening|Antidiabetic Compound Library high throughput|Anti-diabetic Compound high throughput screening| IS900(MAP1793c)   MAP1792.F CAATGGATGGTCGTCACCTG MAP1794.R CGGCCCGCTTGATCCATTTG IS900(MAP2034c)   MAP2033-MAP2034c.F CCGCAAGTAGTGCACTATGG MAP2035.R TATTCGGGGTTGTTCAGGGA IS900(MAP2108)   MAP2105.F CAGGCACGGAACACAGTTCG MAP2109c.R TGTTCGGCTACGGCATACTG IS900(MAP2157)   MAP2156.F CTGCAAACACAGCCCAATC MAP2158.R CAACTTCGGCAAGTTCACC IS900(MAP2203c)   MAP2202c.F TCCCGGTAGAAGATCATGTG MAP2204c.R GACAATCTGCCGTCGTATCA IS900(MAP2444c)   MAP2443.F AACCTTGACCCACACCTTCC MAP2445.R TGAGCTCGCCGGCGAAATA IS900(MAP2577)   MAP2567c.F CGTTCTGGGCATCCATCGACG MAP2578.R TCACGGCGGTCAGGTTACTTC IS900(MAP3480)   MAP3479c.F GTTGAACTTTCCGACCAACC MAP3480-3481.R GGTTAGCGGGAGAAAAGCTC IS900(MAP4066)   MAP4065.F TGGGCCTGAGGTCAGAACCA MAP4067c.R

GAAGACCACCTCTACCTCAC IS900(MAP4281)   MAP4280.F GCTGACCGAGAAGGGCTAC MAP4282.R CGTAAGTGACTGGCTCATGG MAP gene annotation corresponds to GenBank AE016958. vGI-22 was confirmed as a tandem duplication using primer set MAP1789.F and MAP1750.R (Table  6) which produced an amplicon of 2967 bp with selleck chemicals llc Baricitinib vaccine strain 316 F-NLD1978 only. Sequencing of this region showed the duplication event to comprise 40,744 bp spanning 41 ORFs (MAP1749-MAP1789). The duplication site occurs at Genbank accession AE016958 position 1952589 within the first

copy of MAP1790 (truncated at aa173) followed by an overlap region of 3 bp (GGG) and then the second copy of MAP1748c (truncated at aa143) followed by the vGI-22 duplication. PCR with primer pairs specific for this tandem duplication (MAP1789.F, MAP1750.R) was negative for all other strains included in this study. Several attempts to localise the vGI-1b duplication using outward facing primers around the region in a similar manner to vGI-21 and vGI-22 were unsuccessful and this region may not be present in 316UK2000 as a tandem duplication. qPCR was performed using both MAP0101 and MAP0103 specific primer pairs located inside vGI-1b and the relative copy number of each compared against a single copy genome target control represented by primer pairs to MAP2114c. Both MAP0101 and MAP0103 pairs showed a doubling of signal strengths relative to selleckchem MAP2114c in strain 316FUK2000 whilst all other strains included in this study showed signal consistent with single copies of both these genes (Table  7).