Second-round PCR cycle conditions consisted of a denaturation step (7 min at 94°C) and 30 amplification cycles (94°C for 1 min, 59°C for 1 min and 72°C for 1 min) in Taq PCR Mastermix using an Eppendorf Mastercycler ep 543X instrument (Eppendorf, Mississauga,

Canada). The primers used were as follows: L-M667 – ATGCCACGTAAGCGAAACTCTGGCTAACTAGGGAACCCACTG; Alu 1 – TCCCAGCTACTGGGGAGGCTGAGG; Alu 2 –  GCCTCCCAAAGTGCTGGGATTACAG; Lambda T – ATGCCACGTAAGCGAAACT; and AA55M – GCTAGAGATTTTCCACACTGACTAA. A total of 250 000 MDDCs differentiated and infected as described above were incubated in 5 ml polypropylene round-bottomed tubes with 1 mg of FITC-conjugated dextran BMS-777607 (Sigma-Aldrich, Milwaukee, selleck kinase inhibitor WI, USA) in the dark for 1 h on ice or at 37°C

and 5% CO2. Cells were then washed in phosphate-buffered saline (PBS) and subjected to flow cytometric analysis using FCS Express 2·00 software. Changes in the phosphorylation of the ERK, JNK and p38 proteins in response to LPS after HIV-1 infection were measured using immunoblot analysis, as described previously [60]. HIV-1-infected or -uninfected MDDCs were centrifuged, incubated in the presence or absence of 2 µg/µl LPS (Escherichia coli, 0111:B4; Sigma-Aldrich) for 1 h at 37°C and 5% CO2. Cells were then collected by centrifugation, washed, and then lysed on ice using 250 µl lysis buffer [0·05 M HEPES, 0·15 M NaCl, 10% glycerol, 1% Triton-X-100, 7·5 × 10−4 M MgCl2, 0·1 M NaF and 0·001 M ethylene glycol tetraacetic acid (EGTA) heptaminol (pH 7·7)] (Fisher Scientific Canada Limited, Ottawa, ON, Canada). Samples were boiled with ×4 treatment buffer [8% sodium dodecyl sulphate (SDS), 10% 2-mercaptoethanol, 30% glycerol, 0·008% bromophenol blue, 0·25 M Tris HCl] for 10 min, and 40 µg of total protein of each lysate was added to each well of an 8% SDS polyacrylamide gel and subjected to electrophoresis. Next, proteins were transferred electrophoretically to nitrocellulose sheets (Protran®, Bioscience, Schleicher

and Schuell, Mandel, ON, Canada) via semidry electrophoretic transfer (Biorad Labratories Inc., Burlington, ON, Canada) and blocked with Amersham™ ECL Advance Blocking agent (GE-Healthcare Bio-Sciences). The membranes were incubated at 4°C with the primary phosphorylated anti-p38, JNK/stress-activated protein kinase (SAPK) or ERK1/2 and β-actin antibodies (9215S, 9251S, 99101S and 4967; Cell Signaling Technologies, New England Biolabs Limited, Toronto, ON, Canada) at a titre of 1:500 in Amersham™ ECL Advance Blocking agent in ×1 Tris-buffered saline (TBS) (Fisher Scientific Canada Limited) plus Tween 20 (Fisher Scientific Canada Limited) (TBST) for 24 h. The membranes were washed and incubated with secondary antibodies bound covalently to horseradish peroxidase (HRP) (Santa Cruz Biotechnology, Santa Cruz, CA, USA) at a titre of 1:1000 in Amersham™ ECL advance blocking agent in TBST at 4°C for 24 h.