Between each precipitation the sample was centrifuged at 3000 rpm for 15 minutes. The precipitated glycogen was submitted to acid hydrolysis in the presence of phenol. The values were expressed in mg/100 mg of wet weight, using the Siu method [26]. Determination of serum cytokines After the period of supplementation and training, measurements of IL-6, TNF-α and IL-10 in plasma were made by ELISA using the R & D Systems Quantikine High Sensitivity kit (R&D Systems, Minneapolis, MN, USA) for each cytokine. The intra-assay coefficient of variance (CV) was 4.1 – 10%, the inter-assay CV was 6.6 – 8%, and the sensitivity was 0.0083 pg/ml [13]. The duplicate plasma aliquots for all cytokines
analysis were used. Corticosterone determination Plasma corticosterone was determined by ELISA, using the Stressgen kit (Corticosterone {Selleck Anti-infection Compound Library|Selleck Antiinfection Compound Library|Selleck Anti-infection Compound Library|Selleck Antiinfection Compound Library|Selleckchem Anti-infection Compound Library|Selleckchem Antiinfection Compound Library|Selleckchem Anti-infection Compound Library|Selleckchem Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|buy Anti-infection Compound Library|Anti-infection Compound Library ic50|Anti-infection Compound Library price|Anti-infection Compound Library cost|Anti-infection Compound Library solubility dmso|Anti-infection Compound Library purchase|Anti-infection Compound Library manufacturer|Anti-infection Compound Library research buy|Anti-infection Compound Library order|Anti-infection Compound Library mouse|Anti-infection Compound Library chemical structure|Anti-infection Compound Library mw|Anti-infection Compound Library molecular weight|Anti-infection Compound Library datasheet|Anti-infection Compound Library supplier|Anti-infection Compound Library in vitro|Anti-infection Compound Library cell line|Anti-infection Compound Library concentration|Anti-infection Compound Library nmr|Anti-infection Compound Library in vivo|Anti-infection Compound Library clinical trial|Anti-infection Compound Library cell assay|Anti-infection Compound Library screening|Anti-infection Compound Library high throughput|buy Antiinfection Compound Library|Antiinfection Compound Library ic50|Antiinfection Compound Library price|Antiinfection Compound Library cost|Antiinfection Compound Library solubility dmso|Antiinfection Compound Library purchase|Antiinfection Compound Library manufacturer|Antiinfection Compound Library research buy|Antiinfection Compound Library order|Antiinfection Compound Library chemical structure|Antiinfection Compound Library datasheet|Antiinfection Compound Library supplier|Antiinfection Compound Library in vitro|Antiinfection Compound Library cell line|Antiinfection Compound Library concentration|Antiinfection Compound Library clinical trial|Antiinfection Compound Library cell assay|Antiinfection Compound Library screening|Antiinfection Compound Library high throughput|Anti-infection Compound high throughput screening| ELISA KIT Stressgen@), Michigan, USA). The sensitivity range of the assay was 32-20.000 ng/ml. The duplicate plasma aliquots for hormone analysis were used. Determination of
glycogen synthetase-alpha (GS-α) mRNA expression in the soleus muscle Total RNA extraction Total RNA was obtained from 100 mg of soleus muscle. The tissue were stored at -70°C until the time of measurement. Cells were lysed using 1 mL of Trizol reagent (Life Technologies, Rockville, MD, USA). After incubation of 5 min at room temperature, 200 μL chloroform was added to the tubes and centrifuged at 12,000 × g. The aqueous phase was transferred to another learn more tube and the RNA was pelleted by centrifugation
(12,000 × g) with cold ethanol and air-dried. After this, RNA pellets were diluted in RNase-free water and treated with DNase I. RNAs were stored at -70°C until the time of measurement. RNA was quantified by measuring absorbance at 260 nm. The purity of the RNAs was assessed by the 260/280 nm ratios and on a 1% agarose gel stained with ethidium bromide at 5 μg per mL [27]. RT-PCR RT-PCR was performed using parameters Selleckchem Temsirolimus described by Innis and Gelfand [28]. The number of cycles used was selected to allow quantitative comparison of the samples in a linear manner. For semi-quantitative PCR analysis, the housekeeping β-actin gene was used as ADAMTS5 reference. The primer sequences and their respective PCR fragment lengths are: GSK3-α sense: AATCTCGGACACCACCTGAGG – 3′; anti-sense: 5′GGAGGGATGAGAATGGCTTG – 3′. Control: β-actina sense: 5′-ATGAAGATCCTGACCGA GCGTG-3′; anti-sense: 5′- TTGCTGATCCACATCTGCTGG-3′. Published guidelines were followed to guard against bacterial and nucleic acid contamination [29]. Analysis of the PCR products The PCR amplification products were analyzed in 1.5% gels containing 0.5 μg per mL of ethidium bromide and were electrophoresed for 1 h at 100 V. The gels were photographed using a DC120 Zoom Digital Camera System from Kodak (Life Technologies, Inc., Rockville, MD, USA).